Download Sialo-Xenoantigenic Glycobiology: Molecular Glycobiology of by Kwon-Ho Song, Cheorl-Ho Kim PDF

By Kwon-Ho Song, Cheorl-Ho Kim

Carbohydrate antigens on glycoconjugates of mammalian cells play an important roles in a number of organic approaches and are epitopes well-known via the immune process, as glycobiology has highly been stepped forward in past times twenty years. The ebook specializes in sialic acid–based xenoantigenes. In pig to human xenotransplantation, publicity of pig organs to human blood ends up in hyper acute rejection (HAR), attributable to transformations in carbohydrate epitopes among human and pig vascular endothelia. even though Gal-antigen as significant antigen used to be eradicated, the remainder non-Gal antigens are thought of to be xenoantigens. Sialosyl-Tn or Hanganutziu-Deicher (HD), are non-Gal antigens particular to common antibodies in human. to beat rejection responses equivalent to HAR, reviews of genes desirous about carbohydrate antigens, inflicting xenoantigenicity, are valuable. wisdom of pig glycosyltransferases also are worthwhile to use to xenoantigen covering or id of the xenoantigenic sialylglycan(s). within the first bankruptcy the screening for pig glycosyltransferase genes for xenoantigens is gifted. within the bankruptcy II to IV the cloning, characterization, and research of the regulatory mechanism of the pig CMAH gene in NeuGc biosynthesis is proven. finally, the results of an alteration of pig glycosylation styles on human serum-mediated cytotoxicity, brought on by human sialyltransferases together with hST6GalNAc IV is presented.

Show description

By Kwon-Ho Song, Cheorl-Ho Kim

Carbohydrate antigens on glycoconjugates of mammalian cells play an important roles in a number of organic approaches and are epitopes well-known via the immune process, as glycobiology has highly been stepped forward in past times twenty years. The ebook specializes in sialic acid–based xenoantigenes. In pig to human xenotransplantation, publicity of pig organs to human blood ends up in hyper acute rejection (HAR), attributable to transformations in carbohydrate epitopes among human and pig vascular endothelia. even though Gal-antigen as significant antigen used to be eradicated, the remainder non-Gal antigens are thought of to be xenoantigens. Sialosyl-Tn or Hanganutziu-Deicher (HD), are non-Gal antigens particular to common antibodies in human. to beat rejection responses equivalent to HAR, reviews of genes desirous about carbohydrate antigens, inflicting xenoantigenicity, are valuable. wisdom of pig glycosyltransferases also are worthwhile to use to xenoantigen covering or id of the xenoantigenic sialylglycan(s). within the first bankruptcy the screening for pig glycosyltransferase genes for xenoantigens is gifted. within the bankruptcy II to IV the cloning, characterization, and research of the regulatory mechanism of the pig CMAH gene in NeuGc biosynthesis is proven. finally, the results of an alteration of pig glycosylation styles on human serum-mediated cytotoxicity, brought on by human sialyltransferases together with hST6GalNAc IV is presented.

Show description

Read Online or Download Sialo-Xenoantigenic Glycobiology: Molecular Glycobiology of Sialylglycan-Xenoantigenic Determinants in Pig to Human Xenotransplantation PDF

Best biomedical engineering books

Protein Engineering and Design

The layout and construction of novel peptides and proteins occupy pivotal positions in technological know-how and expertise and may proceed to take action within the twenty first century. Protein Engineering and layout outlines the swift advances in computer-based modeling, protein engineering, and techniques wanted for protein and peptide education and characterization.

Ambulatory Impedance Cardiography: The Systems and their Applications

”Ambulatory Impedance Cardiography” supplies the reader the required actual history of impedance cardiography (ICG) and at present to be had platforms for hemodynamics holter tracking. It compares ambulatory ICG and different clinically accredited equipment via an up-to-date cutting-edge. The e-book is split in four components.

Bioinspired Approaches for Human-Centric Technologies

The current ebook discusses issues concerning study and improvement of fabrics and units at nanoscale measurement and their respective software in medication and biomedicine. the person chapters provide an in depth cutting-edge evaluation to the special subject. it sounds as if disconnected fields - existence sciences, biomedicine, chemistry, physics, medication and engineering - could be bridged with a hugely interdisciplinary view onto every one topic.

Bioprinting: Principles and Applications

At labs world wide, researchers were experimenting with bioprinting, first simply to see even if it used to be attainable to push cells via a printhead with out killing them (in so much instances it is), after which attempting to make cartilage, bone, epidermis, blood vessels, small bits of liver and different tissues. There are alternative ways to aim to "engineer" tissue — one includes making a scaffold out of plastics or different fabrics and including cells to it.

Extra resources for Sialo-Xenoantigenic Glycobiology: Molecular Glycobiology of Sialylglycan-Xenoantigenic Determinants in Pig to Human Xenotransplantation

Example text

The biological role of pcmah alternative splicing is not yet clear, and thus it will be useful to clarify the difference of NeuGc expression or CMAH activity in various pig tissues. edu Abstract. To examine functional pCMAH activity, we analyzed the changes inNeuAc/NeuGc contents in pcmah-transfected PK15 and ECV304 cells. When human ECV304 cells negative in NeuGc expression were transfected with the pcmah cDNA, NeuGc contents were significantly increased in the transfectants compared to mock control cells.

1 Cell Culture Pig kidney cell line (PK15) obtained from the Korean Cell Line Bank (KCLB; Seoul, Korea) was cultured in Dulbecco’s modified Eagle’s medium (DMEM; WelGENE, Korea) containing 100 units of penicillin-streptomycin per ml and 10% fetal bovine serum (FBS) at 37°C in 5% CO2 incubator/humidified chamber. 1/myc-His expression vector (Invitrogen, Carlsbad, CA). To clone sialyltransferase genes, PCR was performed using EF-Taq polymerase (SolGent, Korea) with human liver cDNA library as the template and the following primer sets containing restriction enzyme sites (BamHI/XhoI) were used: hST6Gal I (NM 173216), 5’AAGGATCCATGATTCACACCA-3’ (sense) and 5’ACTCTAGAGCAGTGAATGGTC -3’ (antisense), hST3Gal II (NM006927), 5’AAGGATCCATGAAGTGCTCCC-3’ (sense) and 5’ACTCTAGAGTTGCCCCGGTAG-3’ (antisense), ST6GalNAc IV (NM 175039) 5’AAGGATCCATGAAGGCTCCGG-3’ (sense) and 5’ACTCTAGACTCAGTCCTCCAG-3’ (antisense).

Et al. 2003). Although studies of transcriptional regulation should ultimately lead to understanding the relationship between CMAH mRNA expression and biological phenomena, no promoter studies were done to date on any of the cmah genes. Therefore, this study represents the first detailed characterization of acmah promoter and provides the first insight into the mechanism(s) regulating the basal promoter activity of pcmah. Identification and analysis of cis-acting elements and interacting transcription factors, which are important for pcmah promoter activity, are essential for understanding the mechanisms of pcmah transcription regulation.

Download PDF sample

Rated 4.06 of 5 – based on 41 votes